pNSU299_CPR1_2
(Plasmid #166071)

• Purpose: Plasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.
• Depositing Lab: Rebecca Burgess
• Publication: Burgess Lab Plasmids (unpublished)

Backbone

• Vector backbone: pRS414
• Backbone manufacturer: Smith JD et al 2016. PMID 26956608
• Vector type: Yeast Expression, CRISPR
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Intergenic region near CPR1
• gRNA/shRNA sequence: CTTAACAGGCATAACCTAGG
• Species: S. cerevisiae (budding yeast)
• Promoter: Tet-inducible

Cloning Information

• Cloning method: Gibson Cloning

Resource Information

• Supplemental Documents:
  • pnsu299_cpr1_2.gb
• A portion of this plasmid was derived from a plasmid made by: Jim Haber/Neal Sugawara

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

gRNA Binding Coordinates: chrIV: 768328-768347 (+ strand) This is a yeast integration plasmid, and should be linearized with BstZ17I (or elsewhere within the TRP1 gene) before transformation for integration into Chromosome V of the yeast genome

Addgene QC identified a G>C difference at the terminal nucleotide of the gRNA compared to the expected sequence. The depositing lab does not know if this difference is of functional consequence.