Skip to main content
Addgene

pGG431
(Plasmid #165615)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165615 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGG211
  • Backbone manufacturer
    Marcus Noyes Lab
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
  • Mutation
    Corrected homology relative to wild type SpCas9 (immediately adjacent to the NheI site upstream of KanR cassette)
  • Promoter TEF1
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATAGGCAAGGCCACCGCTAAG
  • 3′ sequencing primer CTAGACTTCAGGTTGTCTAACTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGG431 was a gift from Marcus Noyes (Addgene plasmid # 165615 ; http://n2t.net/addgene:165615 ; RRID:Addgene_165615)

  • For your References section:

    Engineered dual selection for directed evolution of SpCas9 PAM specificity. Goldberg GW, Spencer JM, Giganti DO, Camellato BR, Agmon N, Ichikawa DM, Boeke JD, Noyes MB. Nat Commun. 2021 Jan 13;12(1):349. doi: 10.1038/s41467-020-20650-x. 10.1038/s41467-020-20650-x PubMed 33441553
Related items: