pGG426_UV5
(Plasmid
#165608)
-
PurposeVector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGG426
-
Backbone manufacturerMarcus Noyes Lab
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsLow or intermediate copy number is expected (high copy is suppressed by the intact rop gene on this plasmid).
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
-
MutationD1135V, S1136R, D1332K and R1333G mutations in SpCas9
- Promoter lacUV5 driving Cas9 VRKG and UV5 driving sgRNA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a
- 3′ sequencing primer ATTCTTCCGACGTGTATACCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGG426_UV5 was a gift from Marcus Noyes (Addgene plasmid # 165608 ; http://n2t.net/addgene:165608 ; RRID:Addgene_165608) -
For your References section:
Engineered dual selection for directed evolution of SpCas9 PAM specificity. Goldberg GW, Spencer JM, Giganti DO, Camellato BR, Agmon N, Ichikawa DM, Boeke JD, Noyes MB. Nat Commun. 2021 Jan 13;12(1):349. doi: 10.1038/s41467-020-20650-x. 10.1038/s41467-020-20650-x PubMed 33441553