dCas9-ddMSK1
(Plasmid #165603)

• Purpose: Expresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)
• Depositing Lab: Isaac Hilton
• Publication: Li et al Nat Commun. 2021 Feb 9;12(1):896. doi: 10.1038/s41467-021-21188-2.

Backbone

• Vector backbone: LentiCRISPR v2
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3 is also a suitable growth strain
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A)
• Species: H. sapiens (human), Synthetic; S. Pyogenes
• Insert Size (bp): 6441
• GenBank ID: NM_001322227.2
• Entrez Gene: RPS6KA5 (a.k.a. MSK1, MSPK1, RLPK)
• Promoter: EF1a
• Tag / Fusion Protein:
  • FLAG Tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCCGGTGCCTAGAGAAGGT

Resource Information

• Supplemental Documents:
  • Lenti-EFS-dCas9-ddMSK1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry