Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Level 1 P4 TaU6 guide acceptor
(Plasmid #165600)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165600 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC
  • Vector type
    CRISPR, Synthetic Biology ; sgRNA acceptor with LacZ Blue/white screening

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TaU6 promoter::LacZ::sgRNA scaffold
  • gRNA/shRNA sequence
    GTGAGACCGCAGCTGGCACG
  • Species
    Synthetic

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains LacZ for blue/white screening

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Level 1 P4 TaU6 guide acceptor was a gift from John Innes Centre - Crop Transformation and Genome Editing Group & Wendy Harwood (Addgene plasmid # 165600 ; http://n2t.net/addgene:165600 ; RRID:Addgene_165600)
  • For your References section:

    CRISPR-Cas9 Based Genome Editing in Wheat. Smedley MA, Hayta S, Clarke M, Harwood WA. Curr Protoc. 2021 Mar;1(3):e65. doi: 10.1002/cpz1.65. 10.1002/cpz1.65 PubMed 33687760