pAAV-Syn-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
(Plasmid #165492)

• Purpose: Neuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activity
• Depositing Lab: Thomas Oertner
• Publication: Yang et al BMC Biol. 2021 Oct 18;19(1):227. doi: 10.1186/s12915-021-01151-9.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4697
• Total vector size (bp): 6470
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
• Alt name: PACmn (darkVenus)
• Species: Synthetic; Beggiatoa
• Insert Size (bp): 1902
• Promoter: hSyn1
• Tag / Fusion Protein:
  • darkVenus

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gactcagcgctgcctcagtctg
• 3′ sequencing primer: GTAATCCAGAGGTTGATTATCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Insert was assembled in the lab of Georg Nagel

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is identical to PACmn but with a point mutation in Venus to reduce fluorescence by about 90% to facilitate combining with fluorescent indicators etc. It was not used in the original publication.