pAAV-Syn-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
(Plasmid
#165492)
-
PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4697
- Total vector size (bp) 6470
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
-
Alt namePACmn (darkVenus)
-
SpeciesSynthetic; Beggiatoa
-
Insert Size (bp)1902
- Promoter hSyn1
-
Tag
/ Fusion Protein
- darkVenus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gactcagcgctgcctcagtctg
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was assembled in the lab of Georg Nagel
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is identical to PACmn but with a point mutation in Venus to reduce fluorescence by about 90% to facilitate combining with fluorescent indicators etc. It was not used in the original publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y) was a gift from Thomas Oertner (Addgene plasmid # 165492 ; http://n2t.net/addgene:165492 ; RRID:Addgene_165492) -
For your References section:
PACmn for improved optogenetic control of intracellular cAMP. Yang S, Constantin OM, Sachidanandan D, Hofmann H, Kunz TC, Kozjak-Pavlovic V, Oertner TG, Nagel G, Kittel RJ, Gee CE, Gao S. BMC Biol. 2021 Oct 18;19(1):227. doi: 10.1186/s12915-021-01151-9. 10.1186/s12915-021-01151-9 PubMed 34663304