pC23-LIC-His-FLAG
(Plasmid #165477)

• Purpose: (Empty Backbone) pET based vector for protein expression in E.coli for targets fused with C-terminal Flag and His
• Depositing Lab: Renato Bruni
• Publication: Bruni et al Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34. doi: 10.1002/0471140864.ps2906s74.

Backbone

• Vector backbone: pET23
• Backbone manufacturer: Novagen
• Vector type: Bacterial Expression
• Tag / Fusion Protein:
  • TEV-FLAG-10x His (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None
• Tag / Fusion Protein:
  • TEV-FLAG-10x His (C terminal on backbone)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5' end of gene of interest. Downstream: add TGAAAATAGAGGTTTTCGGC to the 3' end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.