pCMV3Tag8li-hADARB2-3xFLAG
(Plasmid #165470)

• Purpose: Human ADARB2 mammalian expression vector with 3 C-terminal FLAG tags.
• Depositing Lab: Martin Dorf
• Publication: Li et al Proc Natl Acad Sci U S A. 2014 May 13;111(19):6970-5. doi: 10.1073/pnas.1322545111. Epub 2014 Apr 28.

Backbone

• Vector backbone: pCMV-3Tag-8 modified MCS
• Backbone manufacturer: Stratagene /Agilent
• Backbone size w/o insert (bp): 5200
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Adenosine deaminase RNA specific B2 (inactive)
• Alt name: ADARB2, RED2, ADAR3
• Alt name: BC137477
• Species: H. sapiens (human)
• Insert Size (bp): 2217
• Entrez Gene: ADARB2 (a.k.a. ADAR3, RED2)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: CMV, (T3)
• 3′ sequencing primer: T7, BGH polyA reverse

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Harvard Institute of Proteomics clone HsCD00342724, MGC:169100

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site.