Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV3Tag8li-hADARB2-3xFLAG
(Plasmid #165470)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165470 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-3Tag-8 modified MCS
  • Backbone manufacturer
    Stratagene /Agilent
  • Backbone size w/o insert (bp) 5200
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Adenosine deaminase RNA specific B2 (inactive)
  • Alt name
    ADARB2, RED2, ADAR3
  • Alt name
    BC137477
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2217
  • Entrez Gene
    ADARB2 (a.k.a. ADAR3, RED2)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CMV, (T3)
  • 3′ sequencing primer T7, BGH polyA reverse
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Harvard Institute of Proteomics clone HsCD00342724, MGC:169100

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Backbone contains new MCS (multiple cloning site). MCS is changed to: ctcgagctgaagcttcatggatccaaagcggccgcaatcgat (XhoI-ctg-HindIII-cat-BamHI-aaa-NotI-a-ClaI). CDS without stop codon was inserted into MCS at unkown restriction enzyme sites, and it expresses in frame with 3xFLAG epitope tag. Xhoi was probably the 5' cloning site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV3Tag8li-hADARB2-3xFLAG was a gift from Martin Dorf (Addgene plasmid # 165470 ; http://n2t.net/addgene:165470 ; RRID:Addgene_165470)
  • For your References section:

    TRIM65 regulates microRNA activity by ubiquitination of TNRC6. Li S, Wang L, Fu B, Berman MA, Diallo A, Dorf ME. Proc Natl Acad Sci U S A. 2014 May 13;111(19):6970-5. doi: 10.1073/pnas.1322545111. Epub 2014 Apr 28. 10.1073/pnas.1322545111 PubMed 24778252