pEXPqcxip-hFTSJ3-FLAG
(Plasmid #165463)

• Purpose: Human FTSJ3 retroviral mammalian expression vector. FLAG/Gateway modified pQCXIP vector with C-terminal FLAG epitope and bicistronic puromycin expression.
• Depositing Lab: Martin Dorf
• Publication: Li et al Proc Natl Acad Sci U S A. 2014 May 13;111(19):6970-5. doi: 10.1073/pnas.1322545111. Epub 2014 Apr 28.

Backbone

• Vector backbone: pQCXIP Gateway modified
• Backbone manufacturer: Clontech /Takara
• Backbone size w/o insert (bp): 7200
• Vector type: Mammalian Expression, Retroviral ; Gateway
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FtsJ RNA 2'-O-methyltransferase 3
• Alt name: FTSJ3, SPB1, EPCS3
• Alt name: BC036710
• Species: H. sapiens (human)
• Insert Size (bp): 2541
• Entrez Gene: FTSJ3 (a.k.a. EPCS3, SPB1)
• Promoter: CMV/MSV, 5'LTR
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: acgccatccacgctgttttgacct
• 3′ sequencing primer: gggcggaattccggat

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Harvard Institute of Proteomics clone ID.s: HsCD00041273, FLH185237.01L

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This Expression vector derived from recombination of HIP Gateway Entry clone HsCD00041273 with a Destination vector, which is pQCXIP modified with a Gateway cassette, and a C-terminal FLAG. Construct has 25bp attB sequences surrounding the insert: attB1-ccacc-[FTSJ3 CDS no stop 2541bp]-ttgg-attB2(25bp)-g-FLAG (24bp)-tga(stop)-IRES-puromycin. pQCXIP is a self inactivating retroviral vector (only in a host cell) and has bicistronic expression of puromycin on the same transcript as the insert. Note, some CMV primers land more than one time.