pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
(Plasmid #165450)

• Purpose: Express N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoter
• Depositing Lab: Elvir Becirovic
• Publication: Bohm et al Sci Adv. 2020 Aug 19;6(34):eaba5614. doi: 10.1126/sciadv.aba5614. eCollection 2020 Aug.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4670
• Total vector size (bp): 7167
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: dCas9N-IntN
• Species: Streptococcus pyogenes
• Insert Size (bp): 2490
• Promoter: short human rhodopsin promoter

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggtcagaacccagagtcatc
• 3′ sequencing primer: ATTCTAGTTGTGGTTTGTCCAA

Gene/Insert 2

• Gene/Insert name: 3x Opn1mw promoter-targeting sgRNAs
• Species: Streptococcus pyogenes
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SgsI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: agatcggaattcgcccttaa
• 3′ sequencing primer: ACACTAGGAGGAAGCCTGAG

Resource Information

• Supplemental Documents:
  • pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA.gbk
• A portion of this plasmid was derived from a plasmid made by: pSMVP-Cas9N, Addgene plasmid 80934
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry