pLD037-pCMV-APOBEC-Cas9(D10A)-rXRCC1
(Plasmid
#165444)
-
PurposeExpresses ACX, rXRCC1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneCMV
-
Backbone manufacturerorigene
- Backbone size w/o insert (bp) 3399
- Total vector size (bp) 10173
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPOBEC-nCas9-rXRCC1
-
Alt namerAPOBEC1-XTEN-Cas9n-rXRCC1-NLS
-
SpeciesR. norvegicus (rat), Synthetic; Streptococcus pyogenes
-
Insert Size (bp)6774
-
Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLD037-pCMV-APOBEC-Cas9(D10A)-rXRCC1 was a gift from Wei Leong Chew (Addgene plasmid # 165444 ; http://n2t.net/addgene:165444 ; RRID:Addgene_165444) -
For your References section:
Programmable C:G to G:C genome editing with CRISPR-Cas9-directed base excision repair proteins. Chen L, Park JE, Paa P, Rajakumar PD, Prekop HT, Chew YT, Manivannan SN, Chew WL. Nat Commun. 2021 Mar 2;12(1):1384. doi: 10.1038/s41467-021-21559-9. 10.1038/s41467-021-21559-9 PubMed 33654077