pSpCas9_U6_sgRNA_Mettl3C
(Plasmid
#165420)
-
PurposesgRNA construct for targeting Mettl3 C-terminus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepx459 v2
-
Backbone manufacturerDr. Feng Zhang's Lab
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePspCas9 gRNA targeting Mettl3 C-terminus
-
gRNA/shRNA sequenceAAGGTGTGGCCTGTAGCCCA
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_019721
-
Entrez GeneMettl3 (a.k.a. 2310024F18Rik, M6A, Spo8)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer unknown
- 3′ sequencing primer unknown (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9_U6_sgRNA_Mettl3C was a gift from Neil Brockdorff (Addgene plasmid # 165420 ; http://n2t.net/addgene:165420 ; RRID:Addgene_165420) -
For your References section:
Acute depletion of METTL3 implicates N (6)-methyladenosine in alternative intron/exon inclusion in the nascent transcriptome. Wei G, Almeida M, Pintacuda G, Coker H, Bowness JS, Ule J, Brockdorff N. Genome Res. 2021 Aug;31(8):1395-1408. doi: 10.1101/gr.271635.120. Epub 2021 Jun 15. 10.1101/gr.271635.120 PubMed 34131006