pCMV-ABE8e-NRCH
(Plasmid #165416)

• Purpose: Expresses the base editor ABE8e-NRCH in mammalian cells
• Depositing Lab: David Liu
• Publication: ABE8e-NRCH for bacterial and human expression (unpublished)

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 3402
• Total vector size (bp): 8217
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ABE8e-NRCH
• Species: Synthetic
• Insert Size (bp): 4815
• Promoter: CMV
• Tags / Fusion Proteins:
  • BP-NLS (N terminal on insert)
  • BP-NLS (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: ATGGCTGGCAACTAGAAGG

Resource Information

• Supplemental Documents:
  • pCMV-ABE8e-NRCH.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry