pDDGFP-Leu2d_GgPCFT
(Plasmid #165414)

• Purpose: expression GgPCFT protein with C terminally tagged GFP-His tag cleavable with TEV protease.
• Depositing Lab: Simon Newstead
• Publication: Parker et al Nature. 2021 May 26. pii: 10.1038/s41586-021-03579-z. doi: 10.1038/s41586-021-03579-z.

Backbone

• Vector backbone: pDDGFP_LEU2d
• Backbone size w/o insert (bp): 8654
• Total vector size (bp): 10000
• Vector type: Yeast Expression
• Selectable markers: LEU2, URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GgPCFT
• Species: G. gallus (chicken), Synthetic
• Insert Size (bp): 1419
• GenBank ID:
• Entrez Gene: SLC46A1 (a.k.a. PCFT)
• Promoter: GAL1
• Tag / Fusion Protein:
  • GFP-His8 (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cttcttattcaaatgtaa
• 3′ sequencing primer: agaaaatttgtgaccattaac

Resource Information

• Supplemental Documents:
  • GgPCFT1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry