pSB3K3-CT66
(Plasmid
#165405)
-
PurposeBacteria gene circuit on medium copy backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 165405 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB3K3
- Backbone size w/o insert (bp) 2750
- Total vector size (bp) 5799
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCT66 gene circuit
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)3049
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the LuxR (S116A, V135I, M174I) sequence variant does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB3K3-CT66 was a gift from Xiaojun Tian (Addgene plasmid # 165405 ; http://n2t.net/addgene:165405 ; RRID:Addgene_165405) -
For your References section:
Winner-takes-all resource competition redirects cascading cell fate transitions. Zhang R, Goetz H, Melendez-Alvarez J, Li J, Ding T, Wang X, Tian XJ. Nat Commun. 2021 Feb 8;12(1):853. doi: 10.1038/s41467-021-21125-3. 10.1038/s41467-021-21125-3 PubMed 33558556