pET42b-AncBE4max
(Plasmid
#165157)
-
PurposeExpresses NLS-AncBE4max-NLS with an N-terminal His Tag (6xHis) for bacterial expression
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 165157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepET42b
- Backbone size w/o insert (bp) 5218
- Total vector size (bp) 10771
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAncBE4max
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5553
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byhttps://www.addgene.org/112094/
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET42b-AncBE4max was a gift from Taekjip Ha (Addgene plasmid # 165157 ; http://n2t.net/addgene:165157 ; RRID:Addgene_165157) -
For your References section:
Cas9 deactivation with photocleavable guide RNAs. Zou RS, Liu Y, Wu B, Ha T. Mol Cell. 2021 Apr 1;81(7):1553-1565.e8. doi: 10.1016/j.molcel.2021.02.007. Epub 2021 Mar 3. 10.1016/j.molcel.2021.02.007 PubMed 33662274
