Skip to main content
Addgene

Nsp10-EGFP
(Plasmid #165115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165115 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFPN1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nsp10
  • Species
    codon optimized SARS-COV-2
  • Insert Size (bp)
    420
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GTCGTAACAACTCCGCCC
  • 3′ sequencing primer CGTCCAGCTCGACCAGGATG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Inserts were prepared by PCR with templates that have been published elsewhere: Gordon et al., 2020a.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.12.19.423586v1 for BioRxiv preprint. bioRxiv 2020.12.19.423586v1

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Nsp10-EGFP was a gift from Bruno Antonny (Addgene plasmid # 165115 ; http://n2t.net/addgene:165115 ; RRID:Addgene_165115)
  • For your References section:

    A comprehensive library of fluorescent constructs of SARS-CoV-2 proteins and their initial characterisation in different cell types. Miserey-Lenkei S, Trajkovic K, D'Ambrosio JM, Patel AJ, Copic A, Mathur P, Schauer K, Goud B, Albanese V, Gautier R, Subra M, Kovacs D, Barelli H, Antonny B. Biol Cell. 2021 Jul;113(7):311-328. doi: 10.1111/boc.202000158. Epub 2021 May 10. 10.1111/boc.202000158 PubMed 33666950