Skip to main content
Addgene

RfxCas13d-backbone
(Plasmid #165078)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165078 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scaffold gRNA
  • gRNA/shRNA sequence
    aacccctaccaactggtcggggtttgaaac
  • Species
    Other

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that viral vectors are prone to recombination. Addgene recommends testing 2-4 individual colonies to ensure the full plasmid is intact.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RfxCas13d-backbone was a gift from Ling-Ling Chen (Addgene plasmid # 165078 ; http://n2t.net/addgene:165078 ; RRID:Addgene_165078)

  • For your References section:

    Screening for functional circular RNAs using the CRISPR-Cas13 system. Li S, Li X, Xue W, Zhang L, Yang LZ, Cao SM, Lei YN, Liu CX, Guo SK, Shan L, Wu M, Tao X, Zhang JL, Gao X, Zhang J, Wei J, Li J, Yang L, Chen LL. Nat Methods. 2021 Jan;18(1):51-59. doi: 10.1038/s41592-020-01011-4. Epub 2020 Dec 7. 10.1038/s41592-020-01011-4 PubMed 33288960
Related items:
Commonly requested with: