Skip to main content
Addgene

aav-tnt-actn2-gfp
(Plasmid #165034)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165034 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    aav-tnt-gfp-v2
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ACTN2
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Actn2 (a.k.a. 1110008F24Rik)
  • Promoter cTNT
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer GTGTCCACTCCCAGTTCAATTACAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    aav-tnt-actn2-gfp was a gift from William Pu (Addgene plasmid # 165034 ; http://n2t.net/addgene:165034 ; RRID:Addgene_165034)
  • For your References section:

    Sarcomeres regulate murine cardiomyocyte maturation through MRTF-SRF signaling. Guo Y, Cao Y, Jardin BD, Sethi I, Ma Q, Moghadaszadeh B, Troiano EC, Mazumdar N, Trembley MA, Small EM, Yuan GC, Beggs AH, Pu WT. Proc Natl Acad Sci U S A. 2021 Jan 12;118(2). pii: 2008861118. doi: 10.1073/pnas.2008861118. 10.1073/pnas.2008861118 PubMed 33361330