Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

GFP-LaM(N)-cpFRB1-T2A-FKBP-LaM(C)
(Plasmid #165026)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 165026 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTriEX
  • Backbone size w/o insert (bp) 5682
  • Total vector size (bp) 6849
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LaM8(N)-cpFRB1-T2A-FKBP-LaM8(C)
  • Species
    Synthetic
  • Insert Size (bp)
    1167
  • Promoter T7
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer EGFPC1F
  • 3′ sequencing primer atctcagtggtatttgtgagccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-LaM(N)-cpFRB1-T2A-FKBP-LaM(C) was a gift from Yubin Zhou (Addgene plasmid # 165026 ; http://n2t.net/addgene:165026 ; RRID:Addgene_165026)
  • For your References section:

    Expanding the Chemogenetic Toolbox by Circular Permutation. Lee YT, He L, Zhou Y. J Mol Biol. 2020 May 1;432(10):3127-3136. doi: 10.1016/j.jmb.2020.03.033. Epub 2020 Apr 8. 10.1016/j.jmb.2020.03.033 PubMed 32277990