CRISPR_HLA_class_I_2
(Plasmid
#164987)
-
PurposeExpression of gRNA targeting multiple HLA-A, HLA-B, and HLA-C genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330 (Addgene #42230)
- Backbone size w/o insert (bp) 9703
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA against HLA class I
-
gRNA/shRNA sequenceCGGCTACTACAACCAGAGCG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (unknown if destroyed)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer U6-F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPR_HLA_class_I_2 was a gift from Matthew Meyerson (Addgene plasmid # 164987 ; http://n2t.net/addgene:164987 ; RRID:Addgene_164987) -
For your References section:
Antigen identification for HLA class I- and HLA class II-restricted T cell receptors using cytokine-capturing antigen-presenting cells. Lee MN, Meyerson M. Sci Immunol. 2021 Jan 22;6(55). pii: 6/55/eabf4001. doi: 10.1126/sciimmunol.abf4001. 10.1126/sciimmunol.abf4001 PubMed 33483338