Skip to main content
Addgene

CRISPR_HLA_class_I_2
(Plasmid #164987)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164987 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX330 (Addgene #42230)
  • Backbone size w/o insert (bp) 9703
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA against HLA class I
  • gRNA/shRNA sequence
    CGGCTACTACAACCAGAGCG
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer U6-F
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRISPR_HLA_class_I_2 was a gift from Matthew Meyerson (Addgene plasmid # 164987 ; http://n2t.net/addgene:164987 ; RRID:Addgene_164987)

  • For your References section:

    Antigen identification for HLA class I- and HLA class II-restricted T cell receptors using cytokine-capturing antigen-presenting cells. Lee MN, Meyerson M. Sci Immunol. 2021 Jan 22;6(55). pii: 6/55/eabf4001. doi: 10.1126/sciimmunol.abf4001. 10.1126/sciimmunol.abf4001 PubMed 33483338
Related items:
Commonly requested with: