pLJM1 FLCN (WT) FLAG GFP
(Plasmid
#164978)
-
PurposeLentiviral vector for FLCN expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164978 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJM1
-
Modifications to backboneCMV promoter was switched to UCB promoter
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLCN
-
Alt nameFolliculin
-
SpeciesH. sapiens (human)
-
Entrez GeneFLCN (a.k.a. BHD, DENND8B, FLCL)
- Promoter UBC
-
Tag
/ Fusion Protein
- 1xFLAG-GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer hUBC-F: TGAAGCTCCGGTTTTGAACT
- 3′ sequencing primer pLJM1-R: GACGTGAAGAATGTGCGAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1 FLCN (WT) FLAG GFP was a gift from Roberto Zoncu (Addgene plasmid # 164978 ; http://n2t.net/addgene:164978 ; RRID:Addgene_164978) -
For your References section:
Structural mechanism of a Rag GTPase activation checkpoint by the lysosomal folliculin complex. Lawrence RE, Fromm SA, Fu Y, Yokom AL, Kim DJ, Thelen AM, Young LN, Lim CY, Samelson AJ, Hurley JH, Zoncu R. Science. 2019 Nov 22;366(6468):971-977. doi: 10.1126/science.aax0364. Epub 2019 Oct 31. 10.1126/science.aax0364 PubMed 31672913