Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVX-NPC1(D786N)-FLAG
(Plasmid #164975)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164975 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLVX-AcGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 9519
  • Total vector size (bp) 13380
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NPC1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3867
  • Mutation
    D786N, insertion L aa15 (please see depositor comments)
  • GenBank ID
  • Entrez Gene
    NPC1 (a.k.a. NPC, POGZ, SLC65A1)
  • Promoter EF1a
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATGCTCCAGACTGCCTTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor confirms insertion of an additional L at aa15 does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-NPC1(D786N)-FLAG was a gift from Roberto Zoncu (Addgene plasmid # 164975 ; http://n2t.net/addgene:164975 ; RRID:Addgene_164975)
  • For your References section:

    NPC1-mTORC1 Signaling Couples Cholesterol Sensing to Organelle Homeostasis and Is a Targetable Pathway in Niemann-Pick Type C. Davis OB, Shin HR, Lim CY, Wu EY, Kukurugya M, Maher CF, Perera RM, Ordonez MP, Zoncu R. Dev Cell. 2020 Dec 7. pii: S1534-5807(20)30925-4. doi: 10.1016/j.devcel.2020.11.016. 10.1016/j.devcel.2020.11.016 PubMed 33308480