pENTR-D-TOPO-kcnn1a
(Plasmid #164956)

• Purpose: Zebrafish kcnn1a gene CDS
• Depositing Lab: GuangJun Zhang
• Publication: Silic et al Dev Dyn. 2021 Mar 16. doi: 10.1002/dvdy.329.

Backbone

• Vector backbone: pENTR-D-TOPO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2580
• Total vector size (bp): 5253
• Vector type: PCR cloning vector

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: kcnn1a
• Alt name: si:rp71-39b20.3
• Species: D. rerio (zebrafish)
• Insert Size (bp): 2673
• Entrez Gene: kcnn1a (a.k.a. si:rp71-39b20.3)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: M13F
• 3′ sequencing primer: M13R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization.