Skip to main content
Addgene

MSCVhyg-HA-FLAG_Ubc9_WT
(Plasmid #164936)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164936 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMSCVhyg
  • Backbone size w/o insert (bp) 6974
  • Total vector size (bp) 7557
  • Vector type
    Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human UBC9
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_194260.3 NM_194260.3
  • Entrez Gene
    UBE2I (a.k.a. C358B7.1, P18, UBC9)
  • Promoter PGK promoter
  • Tag / Fusion Protein
    • FLAG & HA tags (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GACAAATGGAAGTAGCACGTCTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCVhyg-HA-FLAG_Ubc9_WT was a gift from Ji Luo (Addgene plasmid # 164936 ; http://n2t.net/addgene:164936 ; RRID:Addgene_164936)

  • For your References section:

    Oncogenesis driven by the Ras/Raf pathway requires the SUMO E2 ligase Ubc9. Yu B, Swatkoski S, Holly A, Lee LC, Giroux V, Lee CS, Hsu D, Smith JL, Yuen G, Yue J, Ann DK, Simpson RM, Creighton CJ, Figg WD, Gucek M, Luo J. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):E1724-33. doi: 10.1073/pnas.1415569112. Epub 2015 Mar 24. 10.1073/pnas.1415569112 PubMed 25805818
Related items:
Commonly requested with: