Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LentiCRISPRv2 NT sgRNA3
(Plasmid #164929)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164929 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    LentiCRISPRv2
  • Backbone size w/o insert (bp) 12993
  • Total vector size (bp) 13013
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Non-targeting sgRNA3 (verified for knockout)
  • Alt name
    sgRNA3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Promoter EFS promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (not destroyed)
  • 3′ cloning site BsmBI (not destroyed)
  • 5′ sequencing primer aatggactatcatatgcttaccg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2 NT sgRNA3 was a gift from Ji Luo (Addgene plasmid # 164929 ; http://n2t.net/addgene:164929 ; RRID:Addgene_164929)
  • For your References section:

    CRISPR/Cas9-mediated gene knockout is insensitive to target copy number but is dependent on guide RNA potency and Cas9/sgRNA threshold expression level. Yuen G, Khan FJ, Gao S, Stommel JM, Batchelor E, Wu X, Luo J. Nucleic Acids Res. 2017 Nov 16;45(20):12039-12053. doi: 10.1093/nar/gkx843. 10.1093/nar/gkx843 PubMed 29036671