pInducer10b-HA-KRAS G12V CO SR
(Plasmid
#164928)
-
PurposeExpresses HA tagged, codon Optimized and siRNA-resistant, tetracycline-inducible KRASG12V sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepInducer-10b
- Backbone size w/o insert (bp) 12168
- Total vector size (bp) 12778
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAS proto-oncogene, GTPase (KRAS)
-
Alt nameKRAS
-
SpeciesH. sapiens (human)
-
MutationGlycine 12 changed to valine; 9 Valine codons are optimized and siRNA targeting sites are altered without effecting amino acid codons..
-
GenBank IDNM_004985.5
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter Ubc promoter
-
Tag
/ Fusion Protein
- HA tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site Mlu I (unknown if destroyed)
- 5′ sequencing primer ctaccggtagatctaccatg
- 3′ sequencing primer ctgatccttccgcccggacgctcag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer10b-HA-KRAS G12V CO SR was a gift from Ji Luo (Addgene plasmid # 164928 ; http://n2t.net/addgene:164928 ; RRID:Addgene_164928) -
For your References section:
Development of siRNA payloads to target KRAS-mutant cancer. Yuan TL, Fellmann C, Lee CS, Ritchie CD, Thapar V, Lee LC, Hsu DJ, Grace D, Carver JO, Zuber J, Luo J, McCormick F, Lowe SW. Cancer Discov. 2014 Oct;4(10):1182-1197. doi: 10.1158/2159-8290.CD-13-0900. Epub 2014 Aug 6. 10.1158/2159-8290.CD-13-0900 PubMed 25100204