pInducer10b-EGFP-KRAS G12V
(Plasmid #164925)

• Purpose: Expresses EGFP cDNA and KRAS G12V cDNA in mammalian cells
• Depositing Lab: Ji Luo
• Publication: Carver et al PLoS One. 2014 Aug 5;9(8):e103836. doi: 10.1371/journal.pone.0103836. eCollection 2014.

Backbone

• Vector backbone: pInducer-10b
• Backbone size w/o insert (bp): 12176
• Total vector size (bp): 13460
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Enhanced green fluorescent protein
• Alt name: EGFP
• Species: Synthetic
• Insert Size (bp): 717
• Promoter: Ubc promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: Not I (unknown if destroyed)
• 5′ sequencing primer: ACCATGGTGAGCAAGGGCG

Gene/Insert 2

• Gene/Insert name: KRAS proto-oncogene, GTPase (KRAS) G12V mutant
• Alt name: KRAS G12V
• Species: H. sapiens (human)
• Insert Size (bp): 567
• Mutation: Glycine 12 changed to valine (G->T 3156)
• GenBank ID: NM_004985.5
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Promoter: Ubc Promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: Mlu I (unknown if destroyed)
• 5′ sequencing primer: ATGACTGAATATAAACTTGT
• 3′ sequencing primer: CGAGAAGCGCGATCACATGGTCCTGCTGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry