pInducer10b-EGFP-KRAS G12V
(Plasmid
#164925)
-
PurposeExpresses EGFP cDNA and KRAS G12V cDNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepInducer-10b
- Backbone size w/o insert (bp) 12176
- Total vector size (bp) 13460
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEnhanced green fluorescent protein
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter Ubc promoter
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site Not I (unknown if destroyed)
- 5′ sequencing primer ACCATGGTGAGCAAGGGCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameKRAS proto-oncogene, GTPase (KRAS) G12V mutant
-
Alt nameKRAS G12V
-
SpeciesH. sapiens (human)
-
Insert Size (bp)567
-
MutationGlycine 12 changed to valine (G->T 3156)
-
GenBank IDNM_004985.5
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter Ubc Promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site Mlu I (unknown if destroyed)
- 5′ sequencing primer ATGACTGAATATAAACTTGT
- 3′ sequencing primer CGAGAAGCGCGATCACATGGTCCTGCTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer10b-EGFP-KRAS G12V was a gift from Ji Luo (Addgene plasmid # 164925 ; http://n2t.net/addgene:164925 ; RRID:Addgene_164925) -
For your References section:
A high-throughput assay for small molecule destabilizers of the KRAS oncoprotein. Carver J, Dexheimer TS, Hsu D, Weng MT, Smith JL, Guha R, Jadhav A, Simeonov A, Luo J. PLoS One. 2014 Aug 5;9(8):e103836. doi: 10.1371/journal.pone.0103836. eCollection 2014. 10.1371/journal.pone.0103836 PubMed 25093678