MSCVpic2neo-EGFP-FF2
(Plasmid
#164922)
-
PurposeExpresses EGFP cDNA and FF2 shRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSCVpic2
- Backbone size w/o insert (bp) 7140
- Total vector size (bp) 7882
-
Vector typeRetroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEnhanced green fluorescent protein
-
Alt nameEGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNeuropeptide FF receptor 2
-
Alt nameFF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)22
-
Entrez GeneNPFFR2 (a.k.a. GPR74, HLWAR77, NPFF2, NPGPR)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Xho 1 (unknown if destroyed)
- 3′ cloning site Eco R1 (unknown if destroyed)
- 5′ sequencing primer GGGATAACAGGGTAATTGTTTGAATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCVpic2neo-EGFP-FF2 was a gift from Ji Luo (Addgene plasmid # 164922 ; http://n2t.net/addgene:164922 ; RRID:Addgene_164922) -
For your References section:
One-step immortalization of primary human airway epithelial cells capable of oncogenic transformation. Smith JL, Lee LC, Read A, Li Q, Yu B, Lee CS, Luo J. Cell Biosci. 2016 Nov 11;6:57. doi: 10.1186/s13578-016-0122-6. eCollection 2016. 10.1186/s13578-016-0122-6 PubMed 27891214