Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNTI757 P(PGK1)-citrine P(HIS4)-mCherry
(Plasmid #164917)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164917 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR™Blunt II-TOPO®
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 6100
  • Modifications to backbone
    Removed a chunk that included the BamHI and SpeI restriction sites
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    P(PGK1)-citrine and P(HIS4)-mCherry
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
    2623
  • Promoter PGK1 (yeast) and HIS4 (yeast)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Digesting this plasmid with BciVI leaves compatible Gibson homology arms on either side of divergent promoter expression cassette, allowing direct Gibson assembly into the barcoded-gRNA plasmid library. See manuscript for additional details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNTI757 P(PGK1)-citrine P(HIS4)-mCherry was a gift from Nicholas Ingolia (Addgene plasmid # 164917 ; http://n2t.net/addgene:164917 ; RRID:Addgene_164917)
  • For your References section:

    CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes. Muller R, Meacham ZA, Ferguson L, Ingolia NT. Science. 2020 Dec 11;370(6522). pii: 370/6522/eabb9662. doi: 10.1126/science.abb9662. 10.1126/science.abb9662 PubMed 33303588