Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pVER-LacI
(Plasmid #164830)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164830 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAN1818
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    MG1655
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    LacI
  • Alt name
    lac repressor
  • Species
    E. coli
  • Insert Size (bp)
    1083
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTCTCGGCATGGACGAGCTGT
  • 3′ sequencing primer TGCAGCGAGTCAGTGAGCGAGGAAGCACCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    derivative of pAN1818 plasmid
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Derived from the pAN1818 plasmid from the Chris Voigt lab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVER-LacI was a gift from Drew Tack (Addgene plasmid # 164830 ; http://n2t.net/addgene:164830 ; RRID:Addgene_164830)
  • For your References section:

    The genotype-phenotype landscape of an allosteric protein. Tack DS, Tonner PD, Pressman A, Olson ND, Levy SF, Romantseva EF, Alperovich N, Vasilyeva O, Ross D. Mol Syst Biol. 2021 Mar;17(3):e10179. doi: 10.15252/msb.202010179. 10.15252/msb.202010179 PubMed 33784029