Skip to main content
Addgene

pHR_Gal4UAS_4D5-High-CAR-mCherry_PGK_4D5-Low-SynNotch_Gal4VP64_RHL133
(Plasmid #164822)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164822 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHR'SIN
  • Backbone size w/o insert (bp) 9197
  • Total vector size (bp) 13925
  • Modifications to backbone
    pGK promoter and inducible Gal4UAS miniCMV promoter
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AntiHER2 4D5-High Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
  • Species
    Synthetic
  • Insert Size (bp)
    1542
  • Promoter miniCMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tgcaggggaaagaatagtagac
  • 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    AntiHER2 4D5-Low Gal4VP64 synthetic Notch receptor
  • Species
    Synthetic
  • Insert Size (bp)
    2445
  • Promoter pGK

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCTTCAAAAGCGCACGTCT
  • 3′ sequencing primer catagcgtaaaaggagcaaca
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR_Gal4UAS_4D5-High-CAR-mCherry_PGK_4D5-Low-SynNotch_Gal4VP64_RHL133 was a gift from Wendell Lim (Addgene plasmid # 164822 ; http://n2t.net/addgene:164822 ; RRID:Addgene_164822)

  • For your References section:

    T cell circuits that sense antigen density with an ultrasensitive threshold. Hernandez-Lopez RA, Yu W, Cabral KA, Creasey OA, Lopez Pazmino MDP, Tonai Y, De Guzman A, Makela A, Saksela K, Gartner ZJ, Lim WA. Science. 2021 Mar 12;371(6534):1166-1171. doi: 10.1126/science.abc1855. Epub 2021 Feb 25. 10.1126/science.abc1855 PubMed 33632893
Related items:
Commonly requested with: