AAV-CAG-SPOTlight-U2GCR
(Plasmid #164819)

• Purpose: Reporter to measure ISR state-dependent protein synthesis
• Depositing Lab: Nicole Calakos
• Publication: Helseth et al Science. 2021 Apr 23;372(6540). pii: 372/6540/eabe1931. doi: 10.1126/science.abe1931.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2959
• Total vector size (bp): 7008
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SPOTlight-U2GCR
• Alt name: ISR state-dependent protein synthesis reporter
• Insert Size (bp): 2734
• Promoter: CAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: TCCTTGAAGAAGATGGTGCG
• 3′ sequencing primer: TCACTTGTTCCTAGGACACGG

Resource Information

• Supplemental Documents:
  • AAV-SPOTlight-U2GCR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the Addgene verified sequence differs from depositor's reference sequence (see Supplemental Documents above). These differences do not affect plasmid function.