Skip to main content
Addgene

AAV-CAG-SPOTlight-U2GCR
(Plasmid #164819)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164819 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 2959
  • Total vector size (bp) 7008
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SPOTlight-U2GCR
  • Alt name
    ISR state-dependent protein synthesis reporter
  • Insert Size (bp)
    2734
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MfeI (not destroyed)
  • 5′ sequencing primer TCCTTGAAGAAGATGGTGCG
  • 3′ sequencing primer TCACTTGTTCCTAGGACACGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene verified sequence differs from depositor's reference sequence (see Supplemental Documents above). These differences do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CAG-SPOTlight-U2GCR was a gift from Nicole Calakos (Addgene plasmid # 164819 ; http://n2t.net/addgene:164819 ; RRID:Addgene_164819)

  • For your References section:

    Cholinergic neurons constitutively engage the ISR for dopamine modulation and skill learning in mice. Helseth AR, Hernandez-Martinez R, Hall VL, Oliver ML, Turner BD, Caffall ZF, Rittiner JE, Shipman MK, King CS, Gradinaru V, Gerfen C, Costa-Mattioli M, Calakos N. Science. 2021 Apr 23;372(6540). pii: 372/6540/eabe1931. doi: 10.1126/science.abe1931. 10.1126/science.abe1931 PubMed 33888613
Related items:
Commonly requested with: