Skip to main content
Addgene

pCB301TOR-CRISPR
(Plasmid #164797)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164797 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCB301
  • Total vector size (bp) 13119
  • Vector type
    Oomycete expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    PsNLS-hSpCas9
  • Species
    H. sapiens (human); Phytophthora sojae
  • Insert Size (bp)
    -4
  • Promoter HAM34

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ATGCACAAGCGCAAGCGCGAGGA
  • 3′ sequencing primer TTAGTCGCCTCCCAGCTG AGAC
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA expression cassette
  • Promoter RPL41

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GTTCC GTCATTTCCTCGCAGCAAC
  • 3′ sequencing primer AAGCACAATAGGCCCAGACTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB301TOR-CRISPR was a gift from Miaoying Tian (Addgene plasmid # 164797 ; http://n2t.net/addgene:164797 ; RRID:Addgene_164797)

  • For your References section:

    A Phytophthora palmivora Extracellular Cystatin-Like Protease Inhibitor Targets Papain to Contribute to Virulence on Papaya. Gumtow R, Wu D, Uchida J, Tian M. Mol Plant Microbe Interact. 2018 Mar;31(3):363-373. doi: 10.1094/MPMI-06-17-0131-FI. Epub 2018 Jan 3. 10.1094/MPMI-06-17-0131-FI PubMed 29068239
Related items:
Commonly requested with: