EWS-GFP
(Plasmid
#164701)
-
PurposeExpression of EWS-GFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAcGFP-N3
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEWSR1
-
Alt nameEWS
-
SpeciesH. sapiens (human)
-
Entrez GeneEWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
- Promoter CMV
-
Tag
/ Fusion Protein
- AcGFP (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV forward: 5' CGCAAATGGGCGGTAGGCGTG 3'
- 3′ sequencing primer EGFP-N: CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EWS-GFP was a gift from Cheryl Arrowsmith (Addgene plasmid # 164701 ; http://n2t.net/addgene:164701 ; RRID:Addgene_164701)