PRMT8-FLAG
(Plasmid
#164699)
-
PurposeExpression of PRMT8 with a C-terminal FLAG tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePRMT8
-
Alt nameHRMT1L3
-
Alt nameHRMT1L4
-
SpeciesH. sapiens (human)
-
Entrez GenePRMT8 (a.k.a. HRMT1L3, HRMT1L4)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CMV forward: 5' CGCAAATGGGCGGTAGGCGTG 3'
- 3′ sequencing primer BGH: 5' TAGAAGGCACAGTCGAGG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PRMT8-FLAG was a gift from Cheryl Arrowsmith (Addgene plasmid # 164699 ; http://n2t.net/addgene:164699 ; RRID:Addgene_164699)