Skip to main content
Addgene

FLAG-PRMT6(V86K/D88A)
(Plasmid #164698)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164698 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PRMT6
  • Alt name
    HRMT1L6
  • Species
    H. sapiens (human)
  • Mutation
    V86K, D88A
  • Entrez Gene
    PRMT6 (a.k.a. HRMT1L6)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV forward: 5' CGCAAATGGGCGGTAGGCGTG 3'
  • 3′ sequencing primer BGH: 5' TAGAAGGCACAGTCGAGG 3'
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-PRMT6(V86K/D88A) was a gift from Cheryl Arrowsmith (Addgene plasmid # 164698 ; http://n2t.net/addgene:164698 ; RRID:Addgene_164698)

  • For your References section:

    A Potent, Selective, and Cell-Active Inhibitor of Human Type I Protein Arginine Methyltransferases. Eram MS, Shen Y, Szewczyk M, Wu H, Senisterra G, Li F, Butler KV, Kaniskan HU, Speed BA, Dela Sena C, Dong A, Zeng H, Schapira M, Brown PJ, Arrowsmith CH, Barsyte-Lovejoy D, Liu J, Vedadi M, Jin J. ACS Chem Biol. 2016 Mar 18;11(3):772-781. doi: 10.1021/acschembio.5b00839. Epub 2015 Dec 8. 10.1021/acschembio.5b00839 PubMed 26598975
Related items:
Commonly requested with: