pBI-CMV1-mir144[3072 nt]~451-CMV2-mir1
(Plasmid
#164682)
-
PurposeExpress miR-144[3072 nt]~451 and miR-1-1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164682 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBI-CMV1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3114
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemiR-144[3072 nt]~451
-
SpeciesH. sapiens (human)
-
Entrez GeneMIR144 (a.k.a. MIRN144, mir-144)
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CAATGGGAGTTTGTTTTGGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemir-1-1
-
SpeciesH. sapiens (human)
-
Entrez GeneMIR1-1 (a.k.a. MIRN1-1, hsa-mir-1-1, miRNA1-1, mir-1-1)
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TGGGCTATGAACTAATGACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBI-CMV1-mir144[3072 nt]~451-CMV2-mir1 was a gift from David Bartel (Addgene plasmid # 164682 ; http://n2t.net/addgene:164682 ; RRID:Addgene_164682) -
For your References section:
MicroRNA Clustering Assists Processing of Suboptimal MicroRNA Hairpins through the Action of the ERH Protein. Fang W, Bartel DP. Mol Cell. 2020 Apr 16;78(2):289-302.e6. doi: 10.1016/j.molcel.2020.01.026. 10.1016/j.molcel.2020.01.026 PubMed 32302541