pBI-CMV1-mir125-CMV2-mir1
(Plasmid #164668)

• Purpose: Express miR-125a and miR-1-1 in mammalian cells
• Depositing Lab: David Bartel
• Publication: Fang et al Mol Cell. 2020 Apr 16;78(2):289-302.e6. doi: 10.1016/j.molcel.2020.01.026.

Backbone

• Vector backbone: pBI-CMV1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3114
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: miR-125a
• Species: H. sapiens (human)
• Insert Size (bp): 284
• Entrez Gene: MIR125A (a.k.a. MIRN125A, miRNA125A, mir-125a)
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CAATGGGAGTTTGTTTTGGC

Gene/Insert 2

• Gene/Insert name: miR-1-1
• Species: H. sapiens (human)
• Insert Size (bp): 198
• Entrez Gene: MIR1-1 (a.k.a. MIRN1-1, hsa-mir-1-1, miRNA1-1, mir-1-1)
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: PstI (not destroyed)
• 5′ sequencing primer: TGGGCTATGAACTAATGACC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry