CL7-LbCas12a
(Plasmid #164658)

• Purpose: Bacterial expression of LbCas12a using CL7/Im7
• Depositing Lab: Piyush Jain
• Publication: Nguyen et al Methods. 2021 Feb 9. pii: S1046-2023(21)00025-6. doi: 10.1016/j.ymeth.2021.02.001.

Backbone

• Vector backbone: PET
• Backbone manufacturer: TriAltus Bioscience
• Backbone size w/o insert (bp): 6439
• Total vector size (bp): 10210
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LbCas12a
• Alt name: LbCpf1
• Species: Lachnospiraceae bacterium
• Insert Size (bp): 3684
• Promoter: T7
• Tag / Fusion Protein:
  • Thioredoxin, CL7, SUMO (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The vector is derived from TriAltus Bioscience plasmid #21, while the LbCpf1 gene is from Addgene #102566
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry