ERK1C82C202
(Plasmid
#164650)
-
PurposeBacterial expression plasmid for His6-ERK1C82C202
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164650 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneNpT7-5
- Backbone size w/o insert (bp) 2357
- Total vector size (bp) 3521
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameERK1C82C202
-
Alt nameMAPK3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1167
-
MutationK71R/C144S/C178S/C183S/T202C/C271S
-
Entrez GeneMAPK1 (a.k.a. ERK, ERK-2, ERK2, ERT1, MAPK2, NS13, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk, p42-MAPK)
- Promoter T7
-
Tag
/ Fusion Protein
- His6-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMelanie Cobb (Addgene plasmid # 39229; RRID: Addgene_39229; http://n2t.net/addgene:39229)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ERK1C82C202 was a gift from Ben Davis (Addgene plasmid # 164650 ; http://n2t.net/addgene:164650 ; RRID:Addgene_164650) -
For your References section:
LanCLs add glutathione to dehydroamino acids generated at phosphorylated sites in the proteome. Lai KY, Galan SRG, Zeng Y, Zhou TH, He C, Raj R, Riedl J, Liu S, Chooi KP, Garg N, Zeng M, Jones LH, Hutchings GJ, Mohammed S, Nair SK, Chen J, Davis BG, van der Donk WA. Cell. 2021 Apr 27. pii: S0092-8674(21)00436-0. doi: 10.1016/j.cell.2021.04.001. 10.1016/j.cell.2021.04.001 PubMed 33932340