Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ERK1C82C202
(Plasmid #164650)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164650 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    NpT7-5
  • Backbone size w/o insert (bp) 2357
  • Total vector size (bp) 3521
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ERK1C82C202
  • Alt name
    MAPK3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1167
  • Mutation
    K71R/C144S/C178S/C183S/T202C/C271S
  • Entrez Gene
    MAPK1 (a.k.a. ERK, ERK-2, ERK2, ERT1, MAPK2, NS13, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk, p42-MAPK)
  • Promoter T7
  • Tag / Fusion Protein
    • His6-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Melanie Cobb (Addgene plasmid # 39229; RRID: Addgene_39229; http://n2t.net/addgene:39229)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ERK1C82C202 was a gift from Ben Davis (Addgene plasmid # 164650 ; http://n2t.net/addgene:164650 ; RRID:Addgene_164650)
  • For your References section:

    LanCLs add glutathione to dehydroamino acids generated at phosphorylated sites in the proteome. Lai KY, Galan SRG, Zeng Y, Zhou TH, He C, Raj R, Riedl J, Liu S, Chooi KP, Garg N, Zeng M, Jones LH, Hutchings GJ, Mohammed S, Nair SK, Chen J, Davis BG, van der Donk WA. Cell. 2021 Apr 27. pii: S0092-8674(21)00436-0. doi: 10.1016/j.cell.2021.04.001. 10.1016/j.cell.2021.04.001 PubMed 33932340