Skip to main content
Addgene

Δ1-60MEK1C218
(Plasmid #164643)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164643 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    N-terminal truncated mitogen-activated protein kinase kinase 1
  • Alt name
    MAP2K1, MAPKK1, MEK1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    990
  • Mutation
    S218C/C277S/C376S; residues 1-60 at N-terminus were truncated; C-terminal residues QPSTPTHAAGV were deleted.
  • Entrez Gene
    MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
  • Promoter T7
  • Tag / Fusion Protein
    • His6-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genscript.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Δ1-60MEK1C218 was a gift from Ben Davis (Addgene plasmid # 164643 ; http://n2t.net/addgene:164643 ; RRID:Addgene_164643)

  • For your References section:

    LanCLs add glutathione to dehydroamino acids generated at phosphorylated sites in the proteome. Lai KY, Galan SRG, Zeng Y, Zhou TH, He C, Raj R, Riedl J, Liu S, Chooi KP, Garg N, Zeng M, Jones LH, Hutchings GJ, Mohammed S, Nair SK, Chen J, Davis BG, van der Donk WA. Cell. 2021 Apr 27. pii: S0092-8674(21)00436-0. doi: 10.1016/j.cell.2021.04.001. 10.1016/j.cell.2021.04.001 PubMed 33932340
Related items: