lentiGuide-Puro PRMT5-CRISPRi
(Plasmid #164637)

• Purpose: lentiGuide-Puro backbone with cloned target sequence for human PRMT5. The insert is: 5´- CACCGAGCCGCGTGTCCAGCGGGA-3. sgRNA achieves a downregulation of PRMT5 in combination with dCAS9-KRAB-MCP2
• Depositing Lab: Günter Schneider
• Publication: sgRNA MS2 (zeo_backbone) target c-MYC (unpublished)

Backbone

• Vector backbone: lentiGuide-Puro #52963
• Modifications to backbone: PRMT5 inhibitor sequence cloned into the BsmbI site
• Vector type: Mammalian Expression, Lentiviral, CRISPR ; interference
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Use SapI digest to check for unwanted recombination of lentiviral plasmid. Only amplify in RecA- bacteria (eg. Stbl3).
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: target guide sequence PRMT5 inhibition
• Alt name: Protein arginine N-methyltransferase 5
• Species: H. sapiens (human)
• Insert Size (bp): 25
• Entrez Gene: PRMT5 (a.k.a. HRMT1L5, HSL7, IBP72, JBP1, SKB1, SKB1Hs)
• Promoter: U6 and EF1A

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CACCGAGCCGCGTGTCCAGCGGGA
• 3′ sequencing primer: AAACTCCCGCTGGACACGCGGCTC

Resource Information

• Supplemental Documents:
  • sgRNA cloning CRISPR

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry