2xmyc-JIP4
(Plasmid
#164633)
-
PurposeExpresses JIP4 in mammalian cells with a 2xmyc tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164633 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV-Tag3B-2xMYC
- Backbone size w/o insert (bp) 6095
- Total vector size (bp) 8433
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJIP4
-
Alt nameSPAG9
-
Alt nameC-Jun-amino-terminal kinase-interacting protein 4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3962
-
GenBank IDNM_001130528.2 NM_001130528.3
-
Entrez GeneSPAG9 (a.k.a. CT89, HLC-6, HLC4, HLC6, JIP-4, JIP4, JLP, PHET, PIG6)
- Promoter CMV
-
Tag
/ Fusion Protein
- 2xmyc (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atggagctggaggacggtgtggtg
- 3′ sequencing primer tcactcattgccatacatcacttgcca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
2xmyc-JIP4 was a gift from Mark Cookson (Addgene plasmid # 164633 ; http://n2t.net/addgene:164633 ; RRID:Addgene_164633) -
For your References section:
LRRK2 mediates tubulation and vesicle sorting from lysosomes. Bonet-Ponce L, Beilina A, Williamson CD, Lindberg E, Kluss JH, Saez-Atienzar S, Landeck N, Kumaran R, Mamais A, Bleck CKE, Li Y, Cookson MR. Sci Adv. 2020 Nov 11;6(46). pii: 6/46/eabb2454. doi: 10.1126/sciadv.abb2454. Print 2020 Nov. 10.1126/sciadv.abb2454 PubMed 33177079