pET32a-Trx-His6-TEV_SacB
(Plasmid #164588)

• Purpose: Bacterial expression plasmid with sacB gene. Suitable for LIC cloning of a gene insert replacing the sacB.
• Depositing Lab: Ernst Schonbrunn
• Publication: pET32a-Trx-His6-TEV_SacB (unpublished)

Backbone

• Vector backbone: pET32a(+)
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 6500
• Total vector size (bp): 7735
• Modifications to backbone: No
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TEV-SacB
• Species: B. subtilis
• Insert Size (bp): 2013
• Promoter: T7
• Tag / Fusion Protein:
  • Trx-His6 followed by TEV site (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gtaccgagaacctgtacttccaatccatg
• 3′ sequencing primer: cgaattcggatccgtatccacctttactg

Resource Information

• Supplemental Documents:
  • pET-32a(+)_His-TEV-SacB-insert-modified.gb
• A portion of this plasmid was derived from a plasmid made by: The insert gene (SacB) was from Addgene plasmid #26103.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Designed and verified by Md Rezaul Karim (PhD), the responsible scientist. This plasmid is designed to clone a target gene replacing the sacB gene using CPEC (LIC) cloning. Growth media or agar plate with sucrose works as a negative selection marker for the intact template plasmid with the sacB gene and a positive selection marker for the successfully cloned plasmid.