pEVOL-pAzF[TAG]
(Plasmid
#164579)
-
PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164579 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEVOL
- Backbone size w/o insert (bp) 4179
- Total vector size (bp) 6104
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameMj pCNFRS[TAG] (aaRS1)
-
Alt namepAzFRS (1)
-
SpeciesMethanocaldococcus jannaschii (engineered)
-
Insert Size (bp)924
-
MutationY32L L65V F108W Q109M D158G I159P
- Promoter araBAD
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer CTTCTGCGTTCTGATTTAATCTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMj pCNFRS[TAG] (aaRS2)
-
Alt namepAzFRS (2)
-
SpeciesMethanocaldococcus jannaschii (engineered)
-
Insert Size (bp)924
-
MutationY32L L65V F108W Q109M D158G I159P
- Promoter glnS
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCGGTCATCAATCATCC
- 3′ sequencing primer AACTCAATATATTGCAGAGATCATG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameMj tRNA[TAG]
-
Alt nameMj tRNA[CTA]
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)77
- Promoter proK
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGCAGGTAATTCCGCTTCGCAACATGTGAGCACCGG
- 3′ sequencing primer AATAAATCCATGGCAAATTCGACCCTGAGCTGCTCGAGCATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Machinery plasmid for incorporation of para-Azidophenylalanine (pAzF), para-cyanophenylalanine (pCNF), and para-ethynylphenylalanine (pENF) at TAG codons.
Please visit https://doi.org/10.1101/2021.04.12.439361 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEVOL-pAzF[TAG] was a gift from Ryan Mehl (Addgene plasmid # 164579 ; http://n2t.net/addgene:164579 ; RRID:Addgene_164579) -
For your References section:
Genetic Incorporation of Two Mutually Orthogonal Bioorthogonal Amino Acids That Enable Efficient Protein Dual-Labeling in Cells. Bednar RM, Jana S, Kuppa S, Franklin R, Beckman J, Antony E, Cooley RB, Mehl RA. ACS Chem Biol. 2021 Nov 19;16(11):2612-2622. doi: 10.1021/acschembio.1c00649. Epub 2021 Sep 30. 10.1021/acschembio.1c00649 PubMed 34590824