pCS2+methylated-reporter
(Plasmid
#164491)
-
PurposeReporter to test methylated mRNA stability, for mRNA injection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164491 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4692
-
Vector typeProduction of mRNA for zebrafish injection.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameA-less CDS, HA tag, 12x m6A motif 3'UTR
-
Insert Size (bp)597
- Promoter SP6
-
Tag
/ Fusion Protein
- HA tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GCTTGATTTAGGTGACACTATA
- 3′ sequencing primer M13 reverse (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+methylated-reporter was a gift from Antonio Giraldez (Addgene plasmid # 164491 ; http://n2t.net/addgene:164491 ; RRID:Addgene_164491) -
For your References section:
Ythdf m(6)A Readers Function Redundantly during Zebrafish Development. Kontur C, Jeong M, Cifuentes D, Giraldez AJ. Cell Rep. 2020 Dec 29;33(13):108598. doi: 10.1016/j.celrep.2020.108598. 10.1016/j.celrep.2020.108598 PubMed 33378672