Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSP64T-ythdf3-3xflag
(Plasmid #164490)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164490 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSP64T
  • Vector type
    Production of mRNA for zebrafish injection.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ythdf3
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1800
  • Entrez Gene
    ythdf3 (a.k.a. wu:fi35c0, wu:fi35c09, zgc:55441)
  • Promoter SP6
  • Tag / Fusion Protein
    • 3x-flagtag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ACGCTCAACTTTGGCAGATCCG
  • 3′ sequencing primer GGAGCAGATACGAATGGCTACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSP64T-ythdf3-3xflag was a gift from Antonio Giraldez (Addgene plasmid # 164490 ; http://n2t.net/addgene:164490 ; RRID:Addgene_164490)
  • For your References section:

    Ythdf m(6)A Readers Function Redundantly during Zebrafish Development. Kontur C, Jeong M, Cifuentes D, Giraldez AJ. Cell Rep. 2020 Dec 29;33(13):108598. doi: 10.1016/j.celrep.2020.108598. 10.1016/j.celrep.2020.108598 PubMed 33378672