pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA
(Plasmid
#164471)
-
PurposeExpresses sgRNA targeting human GJA1 locus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164471 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459)
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 9220
-
Modifications to backboneInsertion of a sgRNA sequence targeting GJA1
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGap junction alpha-1 (GJA1)
-
Alt nameCX43
-
gRNA/shRNA sequenceAAGCCTACTCAACTGCTGGA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000165.5
-
Entrez GeneGJA1 (a.k.a. AVSD3, CMDR, CX43, EKVP, EKVP3, GJAL, HLHS1, HSS, ODDD, PPKCA)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMatthew R. Cring
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A student in University of Iowa did this cloning.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9(BB)-2A-Puro(PX459)-GJA1 sgRNA was a gift from Markus Kuehn (Addgene plasmid # 164471 ; http://n2t.net/addgene:164471 ; RRID:Addgene_164471) -
For your References section:
Absence of Connexin 43 results in smaller retinas and arrested, depolarized retinal progenitor cells in human retinal organoids. Cheng L, Cring MR, Wadkins DA, Kuehn MH. Stem Cells. 2022 Mar 9. pii: 6545973. doi: 10.1093/stmcls/sxac017. 10.1093/stmcls/sxac017 PubMed 35263762