-
PurposeCre-dependent EF1a-driven expression of mGreenLantern in animals using AAV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemGreenLantern
-
SpeciesH. sapiens (human)
-
Insert Size (bp)720
-
MutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L221K/F223R/G232D
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsp1407I (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TTATGCAGAATGGTAGCTGGATTG
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cre-inducible expression (double floxed inverted ORF)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-DIO-mGreenLantern was a gift from Gregory Petsko (Addgene plasmid # 164468 ; http://n2t.net/addgene:164468 ; RRID:Addgene_164468) -
For your References section:
mGreenLantern: a bright monomeric fluorescent protein with rapid expression and cell filling properties for neuronal imaging. Campbell BC, Nabel EM, Murdock MH, Lao-Peregrin C, Tsoulfas P, Blackmore MG, Lee FS, Liston C, Morishita H, Petsko GA. Proc Natl Acad Sci U S A. 2020 Dec 1;117(48):30710-30721. doi: 10.1073/pnas.2000942117. Epub 2020 Nov 18. 10.1073/pnas.2000942117 PubMed 33208539